[Galaxy-user] galaxy

classic Classic list List threaded Threaded
5 messages Options
Reply | Threaded
Open this post in threaded view
|

[Galaxy-user] galaxy

Laura Elnitski
Can galaxy put header lines between samples when returning genomic DNA? Other servers want to see the separation of sequences in FASTA files.
Thanks,
Laura

Laura Elnitski, Ph.D.

Head Genomic Functional Analysis Section

Genome Technology Branch

National Human Genome Research Institute

National Institutes of Health

5625 Fishers Lane, Rm. 5N-01R

Rockville, MD 20852

phone: 301-451-0265

fax: 301-435-6170



Reply | Threaded
Open this post in threaded view
|

Re: galaxy

Anton Nekrutenko
Fasta headers are lines that start with ">".  What exactly do you mean?

anton


Anton Nekrutenko
Assistant Professor
Department of Biochemistry and Molecular Biology
Center for Comparative Genomics and Bioinformatics
505 Wartik Building
PennState University
University Park, PA 16802
814 865-4752
814 863-6699 FAX
[hidden email]
http://www.bx.psu.edu/~anton
http://g2.bx.psu.edu


On Mar 2, 2006, at 10:43 PM, Laura Elnitski wrote:

> Can galaxy put header lines between samples when returning genomic  
> DNA? Other servers want to see the separation of sequences in FASTA  
> files.
> Thanks,
> Laura
> Laura Elnitski, Ph.D.
> Head Genomic Functional Analysis Section
> Genome Technology Branch
> National Human Genome Research Institute
> National Institutes of Health
> 5625 Fishers Lane, Rm. 5N-01R
> Rockville, MD 20852
> phone: 301-451-0265
> fax: 301-435-6170
>
>
> _______________________________________________
> Galaxy-user mailing list
> [hidden email]
> http://mail.bx.psu.edu/cgi-bin/mailman/listinfo/galaxy-user


Reply | Threaded
Open this post in threaded view
|

Re: galaxy

Anton Nekrutenko
In reply to this post by Laura Elnitski
Do you want to have spaces between FASTA records, so this

 >hg17_chr1_148022106_148022312_+
GTGCTGCAGAGCTTCAAGATAATGGATTACAGCCTCTTGATGTCAATCCA
TAATATAGATCATGCACAACGAGAGCCCTTAAGCAGTGAAACACAGTACT
CAGTTGATACTCGAAGACCGGCCCCCCAAAAGGCTCTGTATTCCACAGCC
ATGGAATCCATCCAGGGAGAGGCTCGACGGGGTGGTACCATGGAGACTGA
TGACCA
 >hg17_chr1_148052068_148052136_+
AGTTTGGCCAGGCGGAATCAGCAGACATTGATGCCAGCTCAGCTATGGAC
ACATCTGAGCCAGCCAAG

looks like this:

 >hg17_chr1_148022106_148022312_+
GTGCTGCAGAGCTTCAAGATAATGGATTACAGCCTCTTGATGTCAATCCA
TAATATAGATCATGCACAACGAGAGCCCTTAAGCAGTGAAACACAGTACT
CAGTTGATACTCGAAGACCGGCCCCCCAAAAGGCTCTGTATTCCACAGCC
ATGGAATCCATCCAGGGAGAGGCTCGACGGGGTGGTACCATGGAGACTGA
TGACCA

 >hg17_chr1_148052068_148052136_+
AGTTTGGCCAGGCGGAATCAGCAGACATTGATGCCAGCTCAGCTATGGAC
ACATCTGAGCCAGCCAAG



Anton Nekrutenko
Assistant Professor
Department of Biochemistry and Molecular Biology
Center for Comparative Genomics and Bioinformatics
505 Wartik Building
PennState University
University Park, PA 16802
814 865-4752
814 863-6699 FAX
[hidden email]
http://www.bx.psu.edu/~anton
http://g2.bx.psu.edu


On Mar 2, 2006, at 10:43 PM, Laura Elnitski wrote:

> Can galaxy put header lines between samples when returning genomic  
> DNA? Other servers want to see the separation of sequences in FASTA  
> files.
> Thanks,
> Laura
> Laura Elnitski, Ph.D.
> Head Genomic Functional Analysis Section
> Genome Technology Branch
> National Human Genome Research Institute
> National Institutes of Health
> 5625 Fishers Lane, Rm. 5N-01R
> Rockville, MD 20852
> phone: 301-451-0265
> fax: 301-435-6170
>
>
> _______________________________________________
> Galaxy-user mailing list
> [hidden email]
> http://mail.bx.psu.edu/cgi-bin/mailman/listinfo/galaxy-user


Reply | Threaded
Open this post in threaded view
|

Re: galaxy

Laura Elnitski
Hi-

I asked for sequence from a list of regions. I got this:
>hg17_chr1_148022106_148022312_+
GTGCTGCAGAGCTTCAAGATAATGGATTACAGCCTCTTGATGTCAATCCA
TAATATAGATCATGCACAACGAGAGCCCTTAAGCAGTGAAACACAGTACT
CAGTTGATACTCGAAGACCGGCCCCCCAAAAGGCTCTGTATTCCACAGCC
ATGGAATCCATCCAGGGAGAGGCTCGACGGGGTGGTACCATGGAGACTGA
TGACCAAGTTTGGCCAGGCGGAATCAGCAGACATTGATGCCAGCTCAGCTATGGAC
ACATCTGAGCCAGCCAAG......continuing for over a hundred thousand bp

 but I need this format to separate the entries:
 >hg17_chr1_148022106_148022312_+
GTGCTGCAGAGCTTCAAGATAATGGATTACAGCCTCTTGATGTCAATCCA
TAATATAGATCATGCACAACGAGAGCCCTTAAGCAGTGAAACACAGTACT
CAGTTGATACTCGAAGACCGGCCCCCCAAAAGGCTCTGTATTCCACAGCC
ATGGAATCCATCCAGGGAGAGGCTCGACGGGGTGGTACCATGGAGACTGA
TGACCA
 >hg17_chr1_148052068_148052136_+
AGTTTGGCCAGGCGGAATCAGCAGACATTGATGCCAGCTCAGCTATGGAC
ACATCTGAGCCAGCCAAG

> next one
etc.

thanks,
Laura


-----Original Message-----
From: Anton Nekrutenko [mailto:[hidden email]]
Sent: Fri 3/3/2006 8:54 AM
To: Elnitski, Laura (NIH/NHGRI) [E]
Cc: [hidden email]
Subject: Re: [Galaxy-user] galaxy
 
Do you want to have spaces between FASTA records, so this

 >hg17_chr1_148022106_148022312_+
GTGCTGCAGAGCTTCAAGATAATGGATTACAGCCTCTTGATGTCAATCCA
TAATATAGATCATGCACAACGAGAGCCCTTAAGCAGTGAAACACAGTACT
CAGTTGATACTCGAAGACCGGCCCCCCAAAAGGCTCTGTATTCCACAGCC
ATGGAATCCATCCAGGGAGAGGCTCGACGGGGTGGTACCATGGAGACTGA
TGACCA
 >hg17_chr1_148052068_148052136_+
AGTTTGGCCAGGCGGAATCAGCAGACATTGATGCCAGCTCAGCTATGGAC
ACATCTGAGCCAGCCAAG

looks like this:

 >hg17_chr1_148022106_148022312_+
GTGCTGCAGAGCTTCAAGATAATGGATTACAGCCTCTTGATGTCAATCCA
TAATATAGATCATGCACAACGAGAGCCCTTAAGCAGTGAAACACAGTACT
CAGTTGATACTCGAAGACCGGCCCCCCAAAAGGCTCTGTATTCCACAGCC
ATGGAATCCATCCAGGGAGAGGCTCGACGGGGTGGTACCATGGAGACTGA
TGACCA

 >hg17_chr1_148052068_148052136_+
AGTTTGGCCAGGCGGAATCAGCAGACATTGATGCCAGCTCAGCTATGGAC
ACATCTGAGCCAGCCAAG



Anton Nekrutenko
Assistant Professor
Department of Biochemistry and Molecular Biology
Center for Comparative Genomics and Bioinformatics
505 Wartik Building
PennState University
University Park, PA 16802
814 865-4752
814 863-6699 FAX
[hidden email]
http://www.bx.psu.edu/~anton
http://g2.bx.psu.edu


On Mar 2, 2006, at 10:43 PM, Laura Elnitski wrote:

> Can galaxy put header lines between samples when returning genomic  
> DNA? Other servers want to see the separation of sequences in FASTA  
> files.
> Thanks,
> Laura
> Laura Elnitski, Ph.D.
> Head Genomic Functional Analysis Section
> Genome Technology Branch
> National Human Genome Research Institute
> National Institutes of Health
> 5625 Fishers Lane, Rm. 5N-01R
> Rockville, MD 20852
> phone: 301-451-0265
> fax: 301-435-6170
>
>
> _______________________________________________
> Galaxy-user mailing list
> [hidden email]
> http://mail.bx.psu.edu/cgi-bin/mailman/listinfo/galaxy-user


Reply | Threaded
Open this post in threaded view
|

Re: galaxy

Anton Nekrutenko
Could you send me your interval file.

Thanks,

anton


Anton Nekrutenko
Assistant Professor
Department of Biochemistry and Molecular Biology
Center for Comparative Genomics and Bioinformatics
505 Wartik Building
PennState University
University Park, PA 16802
814 865-4752
814 863-6699 FAX
[hidden email]
http://www.bx.psu.edu/~anton
http://g2.bx.psu.edu


On Mar 3, 2006, at 9:04 AM, Elnitski, Laura ((NIH/NHGRI)) [E] wrote:

> Hi-
>
> I asked for sequence from a list of regions. I got this:
>> hg17_chr1_148022106_148022312_+
> GTGCTGCAGAGCTTCAAGATAATGGATTACAGCCTCTTGATGTCAATCCA
> TAATATAGATCATGCACAACGAGAGCCCTTAAGCAGTGAAACACAGTACT
> CAGTTGATACTCGAAGACCGGCCCCCCAAAAGGCTCTGTATTCCACAGCC
> ATGGAATCCATCCAGGGAGAGGCTCGACGGGGTGGTACCATGGAGACTGA
> TGACCAAGTTTGGCCAGGCGGAATCAGCAGACATTGATGCCAGCTCAGCTATGGAC
> ACATCTGAGCCAGCCAAG......continuing for over a hundred thousand bp
>
>  but I need this format to separate the entries:
>> hg17_chr1_148022106_148022312_+
> GTGCTGCAGAGCTTCAAGATAATGGATTACAGCCTCTTGATGTCAATCCA
> TAATATAGATCATGCACAACGAGAGCCCTTAAGCAGTGAAACACAGTACT
> CAGTTGATACTCGAAGACCGGCCCCCCAAAAGGCTCTGTATTCCACAGCC
> ATGGAATCCATCCAGGGAGAGGCTCGACGGGGTGGTACCATGGAGACTGA
> TGACCA
>> hg17_chr1_148052068_148052136_+
> AGTTTGGCCAGGCGGAATCAGCAGACATTGATGCCAGCTCAGCTATGGAC
> ACATCTGAGCCAGCCAAG
>
>> next one
> etc.
>
> thanks,
> Laura
>
>
> -----Original Message-----
> From: Anton Nekrutenko [mailto:[hidden email]]
> Sent: Fri 3/3/2006 8:54 AM
> To: Elnitski, Laura (NIH/NHGRI) [E]
> Cc: [hidden email]
> Subject: Re: [Galaxy-user] galaxy
>
> Do you want to have spaces between FASTA records, so this
>
>> hg17_chr1_148022106_148022312_+
> GTGCTGCAGAGCTTCAAGATAATGGATTACAGCCTCTTGATGTCAATCCA
> TAATATAGATCATGCACAACGAGAGCCCTTAAGCAGTGAAACACAGTACT
> CAGTTGATACTCGAAGACCGGCCCCCCAAAAGGCTCTGTATTCCACAGCC
> ATGGAATCCATCCAGGGAGAGGCTCGACGGGGTGGTACCATGGAGACTGA
> TGACCA
>> hg17_chr1_148052068_148052136_+
> AGTTTGGCCAGGCGGAATCAGCAGACATTGATGCCAGCTCAGCTATGGAC
> ACATCTGAGCCAGCCAAG
>
> looks like this:
>
>> hg17_chr1_148022106_148022312_+
> GTGCTGCAGAGCTTCAAGATAATGGATTACAGCCTCTTGATGTCAATCCA
> TAATATAGATCATGCACAACGAGAGCCCTTAAGCAGTGAAACACAGTACT
> CAGTTGATACTCGAAGACCGGCCCCCCAAAAGGCTCTGTATTCCACAGCC
> ATGGAATCCATCCAGGGAGAGGCTCGACGGGGTGGTACCATGGAGACTGA
> TGACCA
>
>> hg17_chr1_148052068_148052136_+
> AGTTTGGCCAGGCGGAATCAGCAGACATTGATGCCAGCTCAGCTATGGAC
> ACATCTGAGCCAGCCAAG
>
>
>
> Anton Nekrutenko
> Assistant Professor
> Department of Biochemistry and Molecular Biology
> Center for Comparative Genomics and Bioinformatics
> 505 Wartik Building
> PennState University
> University Park, PA 16802
> 814 865-4752
> 814 863-6699 FAX
> [hidden email]
> http://www.bx.psu.edu/~anton
> http://g2.bx.psu.edu
>
>
> On Mar 2, 2006, at 10:43 PM, Laura Elnitski wrote:
>
>> Can galaxy put header lines between samples when returning genomic
>> DNA? Other servers want to see the separation of sequences in FASTA
>> files.
>> Thanks,
>> Laura
>> Laura Elnitski, Ph.D.
>> Head Genomic Functional Analysis Section
>> Genome Technology Branch
>> National Human Genome Research Institute
>> National Institutes of Health
>> 5625 Fishers Lane, Rm. 5N-01R
>> Rockville, MD 20852
>> phone: 301-451-0265
>> fax: 301-435-6170
>>
>>
>> _______________________________________________
>> Galaxy-user mailing list
>> [hidden email]
>> http://mail.bx.psu.edu/cgi-bin/mailman/listinfo/galaxy-user
>